World of Books - Find your book here
Happy House:
Betsey Riddle"Bruce Collier wanted it. He's got a fine collection." "Bruce Collier," Mrs. Walbridge pursed her lips thoughtfully. "I've heard his name. Who is he, Paul?" " The chap who wrote 'Reek.' Crichell was talking about him here one night in the summer.
Women, Dissent and Anti-Slavery in Britain and America, ...
Preview37 There are two biographies of Betsey Mix Cowles: Linda L. Geary, Balanced in the Wind: A Biography of Betsey Mix Cowles (Cranberry, NJ: Associated University Presses, 1989); and Donna Marie DeBlasio, 'Her Own Society: The Life and ...
Little Biddle Riddle Book
Richard FischerA riddle contest down on St. Louis's Biddle Street helps six children learn about their city.
Studies in American Indian Literatures: Newsletter of the ...
More editionsJudith A. Ranta. The Life and Writings of Betsey Chamberlain: Native American Mill Worker. Boston: Northeastern University Press, 2003. 284 pp. Kim Lee Judith Ranta's book about the life of Betsey Guppey Chamberlain is divided into two ...
Perl for Exploring DNA
Betsey Dexter DyerMark D. LeBlanc, Betsey Dexter Dyer. # ! /usr/bin/perl use strict; use warnings; my $DNA = "CCGATGCTACGATTTCATTCAGGTC" ; my $complement_DNA; print "5' $DNA 3' \n\n"; # note the use of 5' and 3' # call the subroutine with the $DNA ...
Foolish Jim and Clever James:
Nigel CroserJim is foolish and does silly things. One day the king asks him to solve a riddle. Will Jim solve the riddle and be clever instead?
Dissent Along the Borders of the Fourth World: Native ...
Annalyssa Gypsy MurphyJudith Ranta, The Life and Writings of Betsey Chamberlain: Native American Mill Worker (Boston: Northeastern University Press, 2003), 128. W Judith Ranta, The Life and Writings of Betsey Chamberlain: Native American Mill Worker (Boston: ...
Tracing the History of Eukaryotic Cells: The Enigmatic Smile
Betsey Dexter Dyer-- American Biology Teacher
MJ-12 and the Riddle of Hangar 18: The New Evidence
Timothy Green BecklyHere are classified documents never seen by the public previously.
A Field Guide to Bacteria
Betsey Dexter DyerWritten for curious souls of all ages, this title opens readers eyes--and noses and ears--to this hidden world. Useful illustrations accompany Dyer's lively text.
The riddle of Raven's Gulch
Mary Francis ShuraBart decides to do his own investigation of the events which are giving the ravine along his paper route the reputation of being haunted.
Abolitionism and American Religion
PreviewSome are long-overdue studies of major antislavery leaders, such as Frederick J. Blue's biography of Salmon P. Chase, while others, like Linda L. Geary's biography of Ohioan Betsey Mix Cowles, bring welcome additions to the familiar ...
Tituba of Salem Village
Ann PetryWhen the reverend’s suggestible young daughter, Betsey, starts having fits, the townsfolk declare it to be the devil’s work. Suspicion falls on Tituba, who can read fortunes and spin flax into thread so fine it seems like magic.
who called from an unknown number?